-
Jan 6, 2025 | 
cutt.ly | Basque Research
ORIGINAL RESEARCH article Front. Chem., 06 January 2025 This article is part of the Research Topic Renewable Chemistry View all 4 articles 1 IntroductionThe increasing demand for chemicals in personal and industrial applications has a significant impact on the environment, largely due to fossil-dependent large-scale production (Ramchuran et al., 2023).
-
Oct 21, 2024 | 
cutt.ly | Basque Research
AbstractThe presence of Persistent Organic Pollutants (POP) in consumer products such as electrical and electronic equipment represents a major obstacle for the recycling of the materials they contain at their end-of-life. Current technologies applied to recover plastics from waste electric and electronic equipment (WEEE) struggle to meet the requirements from recyclers regarding restrictions on some of these POPs, mainly brominated flame retardant (BFR) content.
-
Oct 2, 2024 | 
journals.iucr.org | Basque Research |Institut Laue
FullProfAPP is a software tool for data processing, refinement and visualization of large collections of powder diffraction patterns. Featuring an intuitive graphical user interface, it seamlessly facilitates a variety of tasks. These include conducting full-profile phase searches, sequential and high-throughput Rietveld refinements, and managing background (and peak) detection.
-
Aug 1, 2024 | 
pubs.rsc.org | Ander Orue |Basque Research |Albert Einstein |Mikel Arrese-Igor
Enhancing high-voltage solid-state lithium-metal battery performance through a stable solid-electrolyte interphase†
The development of next-generation batteries relies on addressing critical challenges such as the formation of a robust and stable solid electrolyte interphase (SEI) as well as mitigating lithium dendrite propagation.
-
Jun 3, 2024 | 
biorxiv.org | Hyeonsoo Jeong |Isabel Mendizabal |Soojin V. Yi |Basque Research
AbstractSignificant links between aging and DNA methylation are emerging from recent studies. On the one hand, DNA methylation undergoes changes with age, a process termed as epigenetic drift. On the other hand, DNA methylation serves as a readily accessible and accurate biomarker for aging. A key missing piece of information, however, is the molecular mechanisms underlying these processes, and how they are related, if any.
-
May 30, 2024 | 
veterinaryresearch.biomedcentral.com | de la Fuente |Universidad de Córdoba |Ciudad Real |Basque Research
Animal care and procedures were performed by following the guidelines of good experimental practices according to Directive 2010/63/EU of the European Parliament and of the Council of 22 September 2010 on the protection of animals used for scientific purposes [amended by the Regulation (EU) 2019/1010)] and Spanish laws (RD 53/2013). The protocol was approved by the Community of Madrid Ethics Committee (reference PROEX 180.2/22).
-
Apr 1, 2024 | 
parasitesandvectors.biomedcentral.com | Basque Research
ReferencesWilke ABB, Chase C, Vasquez C, Carvajal A, Medina J, Petrie WD, et al. Urbanization creates diverse aquatic habitats for immature mosquitoes in urban areas. Sci Rep. 2019;9:15335. PubMed PubMed Central Google Scholar Ferraguti M, Magallanes S, Ibañez-Justicia A. Implication of human landscape transformation on mosquito populations. In: Gutierrez-Lopez R, Logan JG, de la Puente JM, editors. Ecology of diseases transmitted by mosquitoes to wildlife.
-
Feb 7, 2024 | 
onlinelibrary.wiley.com | Holly K. Kindsvater |Basque Research |Nicholas Dulvy |Maria-José Juan-Jordá
1 INTRODUCTION The body sizes and population biomasses of aquatic species are changing rapidly in response to human-induced environmental change (Oke et al., 2020), motivating the need for mechanistic models to predict future patterns of growth and reproduction (Blanchard et al., 2012; Cheung et al., 2008, 2010; Fernandes et al., 2020).
-
Oct 10, 2023 | 
bmcgenomics.biomedcentral.com | Jose Luis |Jose Ramon |Basque Research
PB (N = 15) and ICV (N = 15) samples used in the RNA-Seq analysis were previously collected from 16 Holstein cows from a single farm in Asturias (Spain) at the time of slaughter as previously described (Table 1) [39]. Animals were 18 months old or older (mean: 4.6 years old). PB from cow ID13 and the ICV from cow ID16 were not available and were not included in the study.
-
Sep 7, 2023 | 
actaneurocomms.biomedcentral.com | Basque Research |Santiago de Compostela
Bacterial expression and purification of bank vole I109 recombinant PrP (rec-PrP) (amino acids 23-231, based on Genbank accession number AF367624 sequence) was performed as described previously [34]. Briefly, pOPIN E expression vector containing the wild-type I109 bank vole Prnp gene was obtained from genomic DNA of bank vole I109 by PCR using the oligonucleotides 5′ AGGAGATATACCATGAAGAAGCGGCCAAAGCCTGG3′ and 5′ GTGATGGTGATGTTTGGAACTTCTCCCTTCGTAGTA3′ and cloned in the pOPIN E expression vector. E.
